NEET Zoology Important & Repeated Questions 2027

Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : All vertebrates are chordates but all chordates are not vertebrate. Reason (R) : The members of subphylum Vertebrata possess notochord during the embryonic period, the notochord is replaced by a cartilaginous or bony vertebral column in adults. In the light of the above statements, choose the correct answer from the options given below : (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true but R is not the correct explanation of A (3) A is true but R is false (4) A is false but R is true

The following are the statements about non-chordates : A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. Choose the most appropriate answer from the options given below : (1) B, C & D only (2) A & C only (3) A, B & D only (4) B, D & E only

Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below: (1) Statement I is false but Statement II is true. (2) Both Statement I and Statement II are true. (3) Both Statement I and Statement II are false. (4) Statement I is true but Statement II is false.

Match List I with List II. List I A. Mast cells B. Inner surface of bronchiole C. Blood D. Tubular parts of nephron List II I. Ciliated epithelium II. Areolar connective tissue III. Cuboidal epithelium IV. specialised connective tissue Choose the correct answer from the options given below: (1) A-III, B-IV, C-II, D-I (2) A-I, B-II, C-IV, D-III (3) A-II, B-III, C-I, D-IV (4) A-II, B-I, C-IV, D-III

Match List I with List II : List I A. Expiratory capacity B. Functional residual capacity C. Vital capacity D. Inspiratory capacity List II I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume II. Tidal volume + Expiratory reserve volume III. Tidal volume + Inspiratory reserve volume IV. Expiratory reserve volume + Residual volume Choose the correct answer from the options given below : (1) A-I, B-III, C-II, D-IV (2) A-II, B-IV, C-III, D-III (3) A-III, B-II, C-IV, D-I (4) A-II, B-I, C-IV, D-III

Match List I with List II : List I A. P wave B. QRS complex C. T wave D. T-P gap List II I. Heart muscles are electrically silent II. Depolarisation of ventricles III. Depolarisation of atria IV. Repolarisation of ventricles Choose the correct answer from the options given below : (1) A-IV, B-II, C-I, D-III (2) A-I, B-III, C-II, D-IV (3) A-III, B-II, C-IV, D-I (4) A-II, B-III, C-I, D-IV

Choose the correct statement given below regarding juxta medullary nephron. (1) Juxta medullary nephrons outnumber the cortical nephrons. (2) Juxta medullary nephrons are located in the columns of Bertini. (3) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla. (4) Loop of Henle of juxta medullary nephron runs deep into medulla.

Match List I with List II : List I A. Fibrous joints B. Cartilaginous joints C. Hinge joints D. Ball and socket joints List II I. Adjacent vertebrae, limited movement II. Humerus and Pectoral girdle, rotational movement III. Skull, don't allow any movement IV. Knee, help in locomotion Choose the correct answer from the options given below : (1) A-III, B-I, C-IV, D-II (2) A-IV, B-II, C-III, D-I (3) A-I, B-III, C-II, D-IV (4) A-III, B-III, C-I, D-IV

Match List I with List II : List I A. Pons B. Hypothalamus C. Medulla D. Cerebellum List II I. Provides additional space for Neurons, regulates posture and balance II. Controls respiration and gastric secretions III. Connects different regions of the brain IV. Neuro secretory cells Choose the correct answer from the options given below : (1) A-II, B-I, C-III, D-IV (2) A-II, B-III, C-I, D-IV (3) A-III, B-IV, C-II, D-I (4) A-I, B-III, C-II, D-IV

Match List - I with List - II. List I: A. Heart B. Kidney C. Gastro-intestinal tract D. Adrenal Cortex List II: I. Erythropoietin II. Aldosterone III. Atrial natriuretic factor IV. Secretin Choose the correct answer from the options given below : (1) A-II, B-I, C-III, D-IV (2) A-IV, B-III, C-II, D-I (3) A-I, B-III, C-IV, D-II (4) A-III, B-I, C-IV, D-II

Consider the following : A. The reductive division for the human female gametogenesis starts earlier than that of the male gametogenesis. B. The gap between the first meiotic division and the second meiotic division is much shorter for males compared to females. C. The first polar body is associated with the formation of the primary oocyte. D. Luteinizing Hormone (LH) surge leads to disintegration of the endometrium and onset of menstrual bleeding. Choose the correct answer from the options given below : (1) A and B are true (2) A and C are true (3) B and D are true (4) B and C are true

The first menstruation is called : (1) Menopause (2) Menarche (3) Diapause (4) Ovulation

Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R : Assertion A : FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R : Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below : (1) A is false but R is true (2) Both A and R are true and R is the correct explanation of A. (3) Both A and R are true but R is NOT the correct explanation of A. (4) A is true but R is false

Which of the following is not a natural/traditional contraceptive method? (1) Vaults (2) Coitus interruptus (3) Periodic abstinence (4) Lactational amenorrhoea

Match List I with List II : List I A. Non-medicated IUD B. Copper releasing IUD C. Hormone releasing IUD D. Implants List II I. Multiload 375 II. Progestogens III. Lippes loop IV. LNG-20 Choose the correct answer from the options given below : (1) A-III, B-I, C-IV, D-II (2) A-II, B-I, C-III, D-IV (3) A-I, B-III, C-IV, D-II (4) A-IV, B-I, C-II, D-III

With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in F3 generation. (Pedigree shown across F0-F3 with symbols: Unaffected male, Affected male, Carrier female, Unaffected female, Affected female.) (1) 1/4 (2) 1/2 (3) 1/8 (4) Zero

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5' (1) 5'ATGTACCGTTTATAGGTAAGT3' (2) 5'AUGUACCGUUUAUAGGUAAGU3' (3) 5'AUGUAAAGUUUAUAGGUAAGU3' (4) 5'AUGUACCGUUUAUAGGGAAGU3'

Sweet potato and potato represent a certain type of evolution. Select the correct combination of terms to explain the evolution. (1) Analogy, convergent (2) Homology, divergent (3) Homology, convergent (4) Analogy, divergent

Match List I with List II : List I A. Common cold B. Haemozoin C. Widal test D. Allergy List II I. Plasmodium II. Typhoid III. Rhinoviruses IV. Dust mites Choose the correct answer from the options given below : (1) A-IV, B-II, C-III, D-I (2) A-II, B-IV, C-III, D-I (3) A-I, B-III, C-II, D-IV (4) A-III, B-I, C-II, D-IV

After maturation, in primary lymphoid organs, the lymphocytes migrate for interaction with antigens to secondary lymphoid organ(s) / tissue(s) like : A. thymus B. bone marrow C. spleen D. lymph nodes E. Peyer's patches Choose the correct answer from the options given below : (1) B, C, D only (2) A, B, C only (3) E, A, B only (4) C, D, E only

Which of the following type of immunity is present at the time of birth and is a non-specific type of defence in the human body? (1) Acquired Immunity (2) Innate Immunity (3) Cell-mediated Immunity (4) Humoral Immunity

Match List I with List II : List I A. Cocaine B. Heroin C. Morphine D. Marijuana List II I. Effective sedative in surgery II. Cannabis sativa III. Erythroxylum IV. Papaver somniferum Choose the correct answer from the options given below : (1) A-III, B-IV, C-I, D-II (2) A-IV, B-III, C-I, D-II (3) A-I, B-III, C-II, D-IV (4) A-II, B-I, C-III, D-IV

Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below : (1) C, D & E only (2) A, B & D only (3) A, B & E only (4) B, C & E only

Which of the following microbes is NOT involved in the preparation of household products? A. Aspergillus niger B. Lactobacillus C. Trichoderma polysporum D. Saccharomyces cerevisiae E. Propionibacterium sharmanii Choose the correct answer from the options given below : (1) A and B only (2) A and C only (3) C and D only (4) C and E only

Which of the following is not a cloning vector? (1) Probe (2) BAC (3) YAC (4) pBR322