NEET Guess Paper 2027

The output (Y) of the given logic implementation is similar to the output of an/a ________ gate. (1) AND (2) NAND (3) OR (4) NOR

The current passing through the battery in the given circuit, is: (1) 2.0 A (2) 0.5 A (3) 2.5 A (4) 1.5 A

A sphere of radius R is cut from a larger solid sphere of radius 2R as shown in the figure. The ratio of the moment of inertia of the smaller sphere to that of the rest part of the sphere about the Y-axis is: (1) 7/8 (2) 7/40 (3) 7/57 (4) 7/64

The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are 8 x 10⁸ N m^-2 and 2 x 10¹¹ N m^-2, is: (1) 8 mm (2) 4 mm (3) 0.4 mm (4) 40 mm

An oxygen cylinder of volume 30 litre has 18.20 moles of oxygen. After some oxygen is withdrawn from the cylinder, its gauge pressure drops to 11 atmospheric pressure at temperature 27 degrees C. The mass of the oxygen withdrawn from the cylinder is nearly equal to: [Given, R = 100/12 J mol^-1 K^-1, and molecular mass of O₂ = 32, 1 atm pressure = 1.01x10⁵ N/m] (1) 0.125 kg (2) 0.144 kg (3) 0.116 kg (4) 0.156 kg

A wire of resistance R is cut into 8 equal pieces. From these pieces two equivalent resistances are made by adding four of these together in parallel. Then these two sets are added in series. The net effective resistance of the combination is: (1) R/64 (2) R/32 (3) R/16 (4) R/8

A full wave rectifier circuit with diodes (D₁) and (D₂) is shown in the figure. If input supply voltage V_in = 220 sin(100 pi t) volt, then at t = 15 msec (1) D₁ is forward biased, D₂ is reverse biased (2) D₁ is reverse biased, D₂ is forward biased (3) D₁ and D₂ both are forward biased (4) D₁ and D₂ both are reverse biased

A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 Nm^-1, then the excess force required to take it away from the surface is: (1) 99 N (2) 19.8 mN (3) 198 N (4) 1.98 mN

A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is (Take permeability of free space as 4 pi x 10^-7 SI units): (1) 44 T (2) 44 mT (3) 4.4 T (4) 4.4 mT

A model for quantized motion of an electron in a uniform magnetic field B states that the flux passing through the orbit of the electron is n(h/e) where n is an integer, h is Planck's constant and e is the magnitude of electron's charge. According to the model, the magnetic moment of an electron in its lowest energy state will be (m is the mass of the electron) (1) he/(pi m) (2) he/(2 pi m) (3) heB/(pi m) (4) heB/(2 pi m)

In an oscillating spring mass system, a spring is connected to a box filled with sand. As the box oscillates, sand leaks slowly out of the box vertically so that the average frequency omega(t) and average amplitude A(t) of the system change with time t. Which one of the following options schematically depicts these changes correctly? (1) omega(t) increasing then saturating with A(t) constant (2) omega(t) increasing with A(t) decreasing (3) omega(t) increasing then saturating with A(t) increasing then saturating (4) omega(t) decreasing with A(t) decreasing

A microscope has an objective of focal length 2 cm, eyepiece of focal length 4 cm and the tube length of 40 cm. If the distance of distinct vision of eye is 25 cm, the magnification in the microscope is (1) 100 (2) 125 (3) 150 (4) 250

A 2 amp current is flowing through two different small circular copper coils having radii ratio 1:2. The ratio of their respective magnetic moments will be (1) 1:4 (2) 1:2 (3) 2:1 (4) 4:1

The plates of a parallel plate capacitor are separated by d. Two slabs of different dielectric constant K₁ and K₂ with thickness (3/8)d and d/2 respectively are inserted in the capacitor. Due to this, the capacitance becomes two times larger than when there is nothing between the plates. If K₁ = 1.25 K₂, the value of K₁ is: (1) 2.66 (2) 2.33 (3) 1.60 (4) 1.33

A balloon is made of a material of surface tension S and its inflation outlet (from where gas is filled in it) has small area A. It is filled with a gas of density rho and takes a spherical shape of radius R. When the gas is allowed to flow freely out of it, its radius r changes from R to 0 (zero) in time T. If the speed v(r) of gas coming out of the balloon depends on r as r^a and T is proportional to S^alpha A^beta rho^gamma R^delta, then (1) a = 1/2, alpha = 1/2, beta = -1, gamma = +1, delta = 3/2 (2) a = -1/2, alpha = -1/2, beta = -1, gamma = -1/2, delta = 5/2 (3) a = -1/2, alpha = 1/2, beta = -1, gamma = 1/2, delta = 7/2 (4) a = 1/2, alpha = 1/2, beta = -1, gamma = 1/2, delta = 7/2

Consider the diameter of a spherical object being measured with the help of a Vernier callipers. Suppose its 10 Vernier Scale Divisions (V.S.D.) are equal to its 9 Main Scale Divisions (M.S.D.). The least division in the M.S. is 0.1 cm and the zero of V.S. is at x = 0.1 cm when the jaws of Vernier callipers are closed. If the main scale reading for the diameter is M = 5 cm and the number of coinciding vernier division is 8, the measured diameter after zero error correction, is (1) 5.18 cm (2) 5.08 cm (3) 4.98 cm (4) 5.00 cm

A parallel plate capacitor made of circular plates is being charged such that the surface charge density on its plates is increasing at a constant rate with time. The magnetic field arising due to displacement current is: (1) zero at all places (2) constant between the plates and zero outside the plates (3) non-zero everywhere with maximum at the imaginary cylindrical surface connecting peripheries of the plates (4) zero between the plates and non-zero outside

An unpolarized light beam travelling in air is incident on a medium of refractive index 1.73 at Brewster's angle. Then- (1) reflected light is completely polarized and the angle of reflection is close to 60 degrees (2) reflected light is partially polarized and the angle of reflection is close to 30 degrees (3) both reflected and transmitted light are perfectly polarized with angles of reflection and refraction close to 60 degrees and 30 degrees, respectively (4) transmitted light is completely polarized with angle of refraction close to 30 degrees

A body weighs 48 N on the surface of the earth. The gravitational force experienced by the body due to the earth at a height equal to one-third the radius of the earth from its surface is: (1) 16 N (2) 27 N (3) 32 N (4) 36 N

Two gases A and B are filled at the same pressure in separate cylinders with movable pistons of radius r_A and r_B, respectively. On supplying an equal amount of heat to both the systems reversibly under constant pressure, the pistons of gas A and B are displaced by 16 cm and 9 cm, respectively. If the change in their internal energy is the same, then the ratio r_A/r_B is equal to (1) 4/3 (2) 3/4 (3) 2/sqrt(3) (4) sqrt(3)/2

There are two inclined surfaces of equal length (L) and same angle of inclination 45 degrees with the horizontal. One of them is rough and the other is perfectly smooth. A given body takes 2 times as much time to slide down on rough surface than on the smooth surface. The coefficient of kinetic friction (mu_k) between the object and the rough surface is close to (1) 0.25 (2) 0.40 (3) 0.5 (4) 0.75

The kinetic energies of two similar cars A and B are 100 J and 225 J respectively. On applying breaks, car A stops after 1000 m and car B stops after 1500 m. If F_A and F_B are the forces applied by the breaks on cars A and B, respectively, then the ratio F_A/F_B is (1) 3/2 (2) 2/3 (3) 1/3 (4) 1/2

The electric field in a plane electromagnetic wave is given by E_z = 60 cos(5x + 1.5x10⁹ t) V/m. Then expression for the corresponding magnetic field is (here subscripts denote the direction of the field) (1) B_y = 2x10^-7 cos(5x + 1.5x10⁹ t) T (2) B_x = 2x10^-7 cos(5x + 1.5x10⁹ t) T (3) B_z = 60 cos(5x + 1.5x10⁹ t) T (4) B_y = 60 sin(5x + 1.5x10⁹ t) T

A ball of mass 0.5 kg is dropped from a height of 40 m. The ball hits the ground and rises to a height of 10 m. The impulse imparted to the ball during its collision with the ground is (Take g = 9.8 m/s²) (1) 21 NS (2) 7 NS (3) 0 (4) 84 NS

In a certain camera, a combination of four similar thin convex lenses are arranged axially in contact. Then the power of the combination and the total magnification in comparison to the power (p) and magnification (m) for each lens will be, respectively - (1) 4p and 4m (2) p⁴ and 4m (3) 4p and m⁴ (4) p⁴ and m⁴

To an ac power supply of 220 V at 50 Hz, a resistor of 20 ohm, a capacitor of reactance 25 ohm and an inductor of reactance 45 ohm are connected in series. The corresponding current in the circuit and the phase angle between the current and the voltage is, respectively - (1) 7.8 A and 30 degrees (2) 7.8 A and 45 degrees (3) 15.6 A and 30 degrees (4) 15.6 A and 45 degrees

The radius of Martian orbit around the Sun is about 4 times the radius of the orbit of Mercury. The Martian year is 687 Earth days. Then which of the following is the length of 1 year on Mercury? (1) 88 earth days (2) 225 earth days (3) 172 earth days (4) 124 earth days

An electric dipole with dipole moment 5x10^-6 Cm is aligned with the direction of a uniform electric field of magnitude 4x10⁵ N/C. The dipole is then rotated through an angle of 60 degrees with respect to the electric field. The change in the potential energy of the dipole is: (1) 0.8 J (2) 1.0 J (3) 1.2 J (4) 1.5 J

A physical quantity P is related to four observations a, b, c and d as follows: P = a³ b² / (c sqrt(d)). The percentage errors of measurement in a, b, c and d are 1%, 3%, 2%, and 4% respectively. The percentage error in the quantity P is (1) 10% (2) 2% (3) 13% (4) 15%

A pipe open at both ends has a fundamental frequency f in air. The pipe is now dipped vertically in a water drum to half of its length. The fundamental frequency of the air column is now equal to: (1) f/2 (2) f (3) 3f/2 (4) 2f

In the above diagram, a strong bar magnet is moving towards solenoid-2 from solenoid-1. The direction of induced current in solenoid-1 and that in solenoid-2, respectively, are through the directions: (1) BA and DC (2) AB and DC (3) BA and CD (4) AB and CD

Match List I with List II. List I (Spectral Lines of Hydrogen for transitions from): A. n₂ = 3 to n₁ = 2 B. n₂ = 4 to n₁ = 2 C. n₂ = 5 to n₁ = 2 D. n₂ = 6 to n₁ = 2 List II (Wavelengths (nm)): I. 410.2 II. 434.1 III. 656.3 IV. 486.1 Choose the correct answer from the options given below: (1) A-I, B-II, C-III, D-IV (2) A-II, B-I, C-IV, D-III (3) A-III, B-IV, C-II, D-I (4) A-IV, B-III, C-I, D-II

Consider the following statements A and B and identify the correct answer (an I-V characteristics graph with quadrants I, II, III, IV is given): A. For a solar-cell, the I-V characteristics lies in the IV quadrant of the given graph. B. In a reverse biased pn junction diode, the current measured in (microA), is due to majority charge carriers. (1) Both A and B are incorrect. (2) A is correct but B is incorrect. (3) A is incorrect but B is correct. (4) Both A and B are correct.

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A: The potential (V) at any axial point, at 2 m distance (r) from the centre of the dipole of dipole moment vector P of magnitude, 4 x 10^-6 C m, is +/- 9 x 10³ V. (Take 1/(4 pi epsilon₀) = 9 x 10⁹ SI units) Reason R: V = +/- 2P/(4 pi epsilon₀ r²), where r is the distance of any axial point, situated at 2 m from the centre of the dipole. In the light of the above statements, choose the correct answer from the options given below: (1) A is false but R is true. (2) Both A and R are true and R is the correct explanation of A. (3) Both A and R are true and R is NOT the correct explanation of A. (4) A is true but R is false.

In an ideal transformer, the turns ratio N_p/N_s = 1/2. The ratio V_s : V_p is equal to (the symbols carry their usual meaning): (1) 1 : 4 (2) 1 : 2 (3) 2 : 1 (4) 1 : 1

If x = 5 sin(pi t + pi/3) m represents the motion of a particle executing simple harmonic motion, the amplitude and time period of motion, respectively, are: (1) 5 m, 1 s (2) 5 cm, 2 s (3) 5 m, 2 s (4) 5 cm, 1 s

The graph which shows the variation of (1/lambda²) and its kinetic energy, E is (where lambda is de Broglie wavelength of a free particle): (1) a straight line through origin of (1/lambda²) vs E (2) an upward opening curve (parabola-like) (3) a decreasing curve (4) a curve saturating with E

At any instant of time t, the displacement of any particle is given by 2t - 1 (SI unit) under the influence of force of 5N. The value of instantaneous power is (in SI unit): (1) 6 (2) 10 (3) 5 (4) 7

The quantities which have the same dimensions as those of solid angle are: (1) angular speed and stress (2) strain and angle (3) stress and angle (4) strain and arc

For the nuclear decay chain: ₈₂²⁹⁰ X --(alpha)--> Y --(e^+)--> Z --(beta^-)--> P --(e^-)--> Q. In the nuclear emission stated above, the mass number and atomic number of the product Q respectively are: (1) 286, 81 (2) 280, 81 (3) 286, 80 (4) 288, 82

Choose the correct circuit which can achieve the bridge balance. (Four Wheatstone bridge circuits with 10 Ohm, 15 Ohm and 5 Ohm resistors, a galvanometer G and cell E with key K are given.) (1) circuit 1 (2) circuit 2 (3) circuit 3 (4) circuit 4

The velocity (v) - time (t) plot of the motion of a body is shown below (a trapezoidal v-t graph: rising, constant, then falling). The acceleration (a) - time (t) graph that best suits this motion is: (1) graph 1 (2) graph 2 (3) graph 3 (4) graph 4

The property which is not of an electromagnetic wave travelling in free space is that: (1) they originate from charges moving with uniform speed. (2) they are transverse in nature. (3) the energy density in electric field is equal to energy density in magnetic field. (4) they travel with a speed equal to 1/sqrt(mu₀ epsilon₀).

The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are 2.14 eV, 2.30 eV and 2.75 eV respectively. If incident electromagnetic radiation has an incident energy of 2.20 eV, which of these photosensitive surfaces may emit photoelectrons? (1) Na only (2) Cs only (3) Both Na and K (4) K only

The angular acceleration of a body, moving along the circumference of a circle, is : (1) along the axis of rotation (2) along the radius, away from centre (3) along the radius towards the centre (4) along the tangent to its position

The ratio of the wavelengths of the light absorbed by a Hydrogen atom when it undergoes n = 2 -> n = 3 and n = 4 -> n = 6 transitions, respectively, is (1) 1/36 (2) 1/16 (3) 1/9 (4) 1/4

Given below are two statements: Statement I: Ferromagnetism is considered as an extreme form of paramagnetism. Statement II: The number of unpaired electrons in a Cr²⁺ ion (Z = 24) is the same as that of a Nd³⁺ ion (Z = 60). In the light of the above statements, choose the correct answer from the options given below: (1) Both Statement I and Statement II are true (2) Both Statement I and Statement II are false (3) Statement I is true but Statement II is false (4) Statement I is false but Statement II is true

Identify the suitable reagent for the following conversion. Methyl benzoate (Ph-CO-OCH₃) -> benzaldehyde (Ph-CHO). (1) (i) LiAlH₄, (ii) H^+/H₂O (2) (i) AlH(iBu)₂ (ii) H₂O (3) (i) NaBH₄, (ii) H^+/H₂O (4) H₂ / Pd-BaSO₄

If the half-life (t₁/2) for a first order reaction is 1 minute, then the time required for 99.9% completion of the reaction is closest to (1) 2 minutes (2) 4 minutes (3) 5 minutes (4) 10 minutes

Predict the major product 'P' in the following sequence of reactions - 1-methylcyclopentene reacting with (i) HBr, benzoyl peroxide (ii) KCN (iii) Na(Hg)/C₂H₅OH -> P (Major). (1) 2-methylcyclopentyl-CH₂NH₂ (2) 1-methylcyclopentyl-CH₂NH₂ (3) 2-methylcyclopentyl-NC (4) 1-methylcyclopentyl bearing NC and CH₃

Consider the following compounds: KO₂, H₂O₂ and H₂SO₄. The oxidation states of the underlined elements (O, O, S) in them are, respectively, (1) +1, -1, and +6 (2) +2, -2, and +6 (3) +1, -2, and +4 (4) +4, -4, and +6

Given below are two statements: Statement I: A hypothetical diatomic molecule with bond order zero is quite stable. Statement II: As bond order increases, the bond length increases. In the light of the above statements, choose the most appropriate answer from the options given below: (1) Both Statement I and Statement II are true (2) Both Statement I and Statement II are false (3) Statement I is true but Statement II is false (4) Statement I is false but Statement II is true

1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to: (1) 200 mg (2) 750 mg (3) 250 mg (4) Zero mg

Match List I with List II. List I (Ion): A. Co²⁺ B. Mg²⁺ C. Pb²⁺ D. Al³⁺. List II (Group Number in Cation Analysis): I. Group-I II. Group-III III. Group-IV IV. Group-VI. Choose the correct answer from the options given below: (1) A-III, B-IV, C-II, D-I (2) A-III, B-IV, C-I, D-II (3) A-III, B-II, C-IV, D-I (4) A-III, B-II, C-I, D-IV

Which of the following are paramagnetic? A. [NiCl₄]^2- B. Ni(CO)₄ C. [Ni(CN)₄]^2- D. [Ni(H₂O)₆]²⁺ E. Ni(PPh₃)₄. Choose the correct answer from the options given below: (1) A and C only (2) B and E only (3) A and D only (4) A, D and E only

Among the following, choose the ones with equal number of atoms. A. 212 g of Na₂CO₃ (s) [molar mass = 106 g] B. 248 g of Na₂O (s) [molar mass = 62 g] C. 240 g of NaOH (s) [molar mass = 40 g] D. 12 g of H₂ (g) [molar mass = 2 g] E. 220 g of CO₂ (g) [molar mass = 44 g]. Choose the correct answer from the options given below: (1) A, B, and C only (2) A, B, and D only (3) B, C, and D only (4) B, D, and E only

Match List I with List II. List I (Mixture): A. CHCl₃ + C₆H₅NH₂ B. Crude oil in petroleum industry C. Glycerol from spent-lye D. Aniline - water. List II (Method of Separation): I. Distillation under reduced pressure II. Steam distillation III. Fractional distillation IV. Simple distillation. Choose the correct answer from the options given below: (1) A-IV, B-III, C-I, D-II (2) A-IV, B-III, C-II, D-I (3) A-III, B-IV, C-I, D-II (4) A-III, B-IV, C-II, D-I

For the reaction A(g) <=> 2B(g), the backward reaction rate constant is higher than the forward reaction rate constant by a factor of 2500, at 1000 K. [Given: R = 0.0831 L atm mol^-1 K^-1] K_p for the reaction at 1000 K is (1) 83.1 (2) 2.077 x 10⁵ (3) 0.033 (4) 0.021

Which of the following aqueous solution will exhibit highest boiling point? (1) 0.01M Urea (2) 0.01M KNO₃ (3) 0.01M Na₂SO₄ (4) 0.015M C₆H₁₂O₆

Sugar 'X': A. is found in honey. B. is a keto sugar. C. exists in alpha and beta - anomeric forms. D. is laevorotatory. 'X' is: (1) D-Glucose (2) D-Fructose (3) Maltose (4) Sucrose

Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A): 1-iodo compound undergoes S_N2 reaction faster than the corresponding 1-chloro compound. Reason (R): Iodine is a better leaving group because of its large size. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true but R is not the correct explanation of A (3) A is true but R is false (4) A is false but R is true

If the molar conductivity (Lambda_m) of a 0.050 mol L^-1 solution of a monobasic weak acid is 90 S cm² mol^-1, its extent (degree) of dissociation will be [Assume Lambda_+⁰ = 349.6 S cm² mol^-1 and Lambda_-⁰ = 50.4 S cm² mol^-1.] (1) 0.115 (2) 0.125 (3) 0.225 (4) 0.215

Which one of the following reactions does NOT belong to "Lassaigne's test"? (1) Na + C + N -heat-> NaCN (2) 2Na + S -heat-> Na₂S (3) Na + X -heat-> NaX (4) 2CuO + C -heat-> 2Cu + CO₂

Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N Choose the correct answer from the options given below: (1) Li < Be < N < B < C (2) Li < Be < B < C < N (3) Li < B < Be < C < N (4) Li < Be < C < B < N

Activation energy of any chemical reaction can be calculated if one knows the value of: (1) rate constant at two different temperatures. (2) rate constant at standard temperature. (3) probability of collision. (4) orientation of reactant molecules during collision.

Match List I with List II. List I (Conversion): A. 1 mol of H₂O to O₂ B. 1 mol of MnO₄^- to Mn²⁺ C. 1.5 mol of Ca from molten CaCl₂ D. 1 mol FeO to Fe₂O₃ List II (Number of Faraday required): I. 3F II. 2F III. 1F IV. 5F Choose the correct answer from the options given below: (1) A-III, B-IV, C-II, D-I (2) A-II, B-IV, C-I, D-III (3) A-III, B-IV, C-I, D-II (4) A-II, B-III, C-I, D-IV

The correct order of the wavelength of light absorbed by the following complexes is. A. [Co(NH₃)₆]³⁺ B. [Co(CN)₆]^3- C. [Cu(H₂O)₄]²⁺ D. [Ti(H₂O)₆]³⁺. Choose the correct answer from the options given below: (1) B < D < A < C (2) B < A < D < C (3) C < D < A < B (4) C < A < D < B

The correct order of decreasing acidity of the following aliphatic acids is (1) (CH₃)₃CCOOH > (CH₃)₂CHCOOH > CH₃COOH > HCOOH (2) CH₃COOH > (CH₃)₂CHCOOH > (CH₃)₃CCOOH > HCOOH (3) HCOOH > CH₃COOH > (CH₃)₂CHCOOH > (CH₃)₃CCOOH (4) HCOOH > (CH₃)₃CCOOH > (CH₃)₂CHCOOH > CH₃COOH

Given below are two statements: Statement I: Benzenediazonium salt is prepared by the reaction of aniline with nitrous acid at 273-278 K. It decomposes easily in the dry state. Statement II: Insertion of iodine into the benzene ring is difficult and hence iodobenzene is prepared through the reaction of benzenediazonium salt with KI. In the light of the above statements, choose the most appropriate answer from the options given below: (1) Both Statement I and Statement II are correct (2) Both Statement I and Statement II are incorrect (3) Statement I is correct but Statement II is incorrect (4) Statement I is incorrect but Statement II is correct

The major product of the following reaction is: PhCO-CH_2-CH_2-CN (3-oxo-3-phenylpropanenitrile chain, i.e. an aryl ketone bearing a nitrile) treated with (i) CH₃MgBr (excess) (ii) H₃O^+. (1) tertiary alcohol from the ketone with CN retained: Ph-C(CH₃)(OH)-CH_2-CN (2) Ph-C(CH₃)(OH)-CH_2-CH_2-CO-CH₃ (alcohol from ketone + methyl ketone from nitrile) (3) diol: Ph-C(CH₃)(OH)-CH_2-C(OH)(CH₃)₂ (4) diketone: Ph-CO-CH_2-CH_2-CO-CH₃

Match List I with List II. List I (Molecule): A. ethane B. ethene C. carbon molecule, C₂ D. ethyne List II (Number and types of bond/s between two carbon atoms): I. one σ-bond and two π-bonds II. two π-bonds III. one σ-bond IV. one σ-bond and one π-bond Choose the correct answer from the options given below: (1) A-III, B-IV, C-I, D-II (2) A-I, B-IV, C-II, D-III (3) A-IV, B-III, C-II, D-I (4) A-III, B-IV, C-II, D-I

Match List I with List II. List I (Quantum Number): A. m_l B. m_s C. l D. n List II (Information provided): I. shape of orbital II. size of orbital III. orientation of orbital IV. orientation of spin of electron Choose the correct answer from the options given below: (1) A-II, B-I, C-IV, D-III (2) A-I, B-III, C-II, D-IV (3) A-III, B-IV, C-I, D-II (4) A-III, B-IV, C-II, D-I

Given below are two statements: Statement I: [Co(NH₃)₆]³⁺ is a homoleptic complex whereas [Co(NH₃)₄Cl₂]^+ is a heteroleptic complex. Statement II: Complex [Co(NH₃)₆]³⁺ has only one kind of ligands but [Co(NH₃)₄Cl₂]^+ has more than one kind of ligands. In the light of the above statements, choose the correct answer from the options given below: (1) Statement I is false but Statement II is true. (2) Both Statement I and Statement II are true. (3) Both Statement I and Statement II are false. (4) Statement I is true but Statement II is false.

Match List I with List II. List I (Compound): A. NH₃ B. BrF₅ C. XeF₄ D. SF₆ List II (Shape/geometry): I. Trigonal Pyramidal II. Square Planar III. Octahedral IV. Square Pyramidal Choose the correct answer from the options given below: (1) A-II, B-III, C-IV, D-I (2) A-I, B-IV, C-II, D-III (3) A-II, B-IV, C-III, D-I (4) A-III, B-IV, C-I, D-II

Given below are two statements: Statement I: The boiling point of hydrides of Group 16 elements follow the order H₂O > H₂Te > H₂Se > H₂S. Statement II: On the basis of molecular mass, H₂O is expected to have lower boiling point than the other members of the group but due to the presence of extensive H-bonding in H₂O, it has higher boiling point. In the light of the above statements, choose the correct answer from the options given below: (1) Statement I is false but Statement II is true. (2) Both Statement I and Statement II are true. (3) Both Statement I and Statement II are false. (4) Statement I is true but Statement II is false.

The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere is: (Given R = 2.0 cal K^-1 mol^-1) (1) 100 calories (2) 0 calorie (3) -413.14 calories (4) 413.14 calories

Consider the following reaction in a sealed vessel at equilibrium with concentrations of N₂ = 3.0×10^-3 M, O₂ = 4.2×10^-3 M and NO = 2.8×10^-3 M. 2 NO_(g) ⇌ N₂(g) + O₂(g) If 0.1 mol L^-1 of NO_(g) is taken in a closed vessel, what will be degree of dissociation (α) of NO_(g) at equilibrium? (1) 0.717 (2) 0.00889 (3) 0.0889 (4) 0.8889

For the given reaction: (cyclohexyl)-CH=CH-(cyclohexyl) --KMnO₄/H^+--> 'P' (major product). 'P' is: (the four options are structures shown in the figure) (1) cyclohexyl-CO-CO-cyclohexyl (diketone) (2) cyclohexanecarbaldehyde (cyclohexyl-CHO) (3) cyclohexanecarboxylic acid (cyclohexyl-COOH) (4) cyclohexyl-CH(OH)-CH(OH)-cyclohexyl (vicinal diol)

Match List-I with List-II: List-I: A. Coke, B. Diamond, C. Fullerene, D. Graphite List-II: I. Carbon atoms are sp³ hybridised. II. Used as a dry lubricant. III. Used as a reducing agent. IV. Cage like molecules Choose the correct answer from the options given below: (1) A-III, B-IV, C-I, D-II (2) A-II, B-IV, C-I, D-III (3) A-IV, B-I, C-II, D-III (4) A-III, B-I, C-IV, D-II

Consider the following compounds/species: i. naphthalene ii. cyclopentadienyl anion iii. cyclobutadiene dication (square four-membered ring) iv. cyclopropenyl anion (three-membered ring with negative charge) v. cyclopropenyl cation (three-membered ring with positive charge) vi. cyclooctatetraene vii. anthracene The number of compounds/species which obey Huckel's rule is ________. (1) 5 (2) 4 (3) 6 (4) 2

Which of the following statements are true? A. Unlike Ga that has a very high melting point, Cs has a very low melting point. B. On Pauling scale, the electronegativity values of N and Cl are not the same. C. Ar, K^+, Cl^-, Ca²⁺, and S^2- are all isoelectronic species. D. The correct order of the first ionization enthalpies of Na, Mg, Al, and Si is Si > Al > Mg > Na. E. The atomic radius of Cs is greater than that of Li and Rb. Choose the correct answer from the options given below: (1) A, B, and E only (2) C and E only (3) C and D only (4) A, C, and E only

Given below are two statements: Statement I: Like nitrogen that can form ammonia, arsenic can form arsine. Statement II: Antimony cannot form antimony pentoxide. In the light of the above statements, choose the most appropriate answer from the options given below: (1) Both Statement I and Statement II are correct (2) Both Statement I and Statement II are incorrect (3) Statement I is correct but Statement II is incorrect (4) Statement I is incorrect but Statement II is correct

Which among the following electronic configurations belong to main group elements? A. [Ne]3s¹ B. [Ar]3d³ 4s² C. [Kr]4d¹⁰ 5s² 5p⁵ D. [Ar]3d¹⁰ 4s¹ E. [Rn]5f⁶ 6d² 7s². Choose the correct answer from the option given below: (1) B and E only (2) A and C only (3) D and E only (4) A, C and D only

Dalton's Atomic theory could not explain which of the following? (1) Law of conservation of mass (2) Law of constant proportion (3) Law of multiple proportion (4) Law of gaseous volume

Which one of the following compounds can exist as cis-trans isomers? (1) Pent-1-ene (2) 2-Methylhex-2-ene (3) 1,1-Dimethylcyclopropane (4) 1,2-Dimethylcyclohexane

Phosphoric acid ionizes in three steps with their ionization constant values K_a1, K_a2 and K_a3, respectively, while K is the overall ionization constant. Which of the following statements are true? A. log K = log K_a1 + log K_a2 + log K_a3 B. H₃PO₄ is a stronger acid than H₂PO₄^- and HPO₄^2- C. K_a1 > K_a2 > K_a3 D. K_a1 = (K_a3 + K_a2)/2. Choose the correct answer from the options given below: (1) A and B only (2) A and C only (3) B, C and D only (4) A, B and C only

Which one of the following reactions does NOT give benzene as the product? (1) Sodium benzoate + sodalime, heat (2) n-hexane over Mo₂O₃ at 773 K, 10-20 atm (3) H-C#C-H (acetylene) through red hot iron tube at 873 K (4) benzenediazonium chloride + H₂O, warm

C(s) + 2H₂(g) -> CH₄(g); Delta H = -74.8 kJ mol^-1. Which of the following diagrams gives an accurate representation of the above reaction? [R -> reactants; P -> products] The four options show energy vs reaction progress profiles: (1) R lower, P higher separated by 74.8 with barrier (2) R higher, products P below by 74.8 (3) R higher, P lower with gap 74.8 (4) R low, P high, exothermic-labelled 74.8. (Exothermic profile where products lie below reactants by 74.8 kJ mol^-1.)

Match List-I with List-II. List-I (Example): A. Humidity B. Alloys C. Amalgams D. Smoke. List-II (Type of Solution): I. Solid in solid II. Liquid in gas III. Solid in gas IV. Liquid in solid. Choose the correct answer from the options given below: (1) A-II, B-IV, C-I, D-III (2) A-II, B-I, C-IV, D-III (3) A-III, B-I, C-IV, D-II (4) A-III, B-II, C-I, D-IV

The correct order of decreasing basic strength of the given amines is (1) N-methylaniline > benzenamine > ethanamine > N-ethylethanamine (2) N-ethylethanamine > ethanamine > benzenamine > N-methylaniline (3) N-ethylethanamine > ethanamine > N-methylaniline > benzenamine (4) benzenamine > ethanamine > N-methylaniline > N-ethylethanamine

Which one of the following is an example of ex-situ conservation? (1) National Park (2) Wildlife Sanctuary (3) Zoos and botanical gardens (4) Protected areas

How many molecules of ATP and NADPH are required for every molecule of CO₂ fixed in the Calvin cycle? (1) 3 molecules of ATP and 2 molecules of NADPH (2) 2 molecules of ATP and 3 molecules of NADPH (3) 2 molecules of ATP and 2 molecules of NADPH (4) 3 molecules of ATP and 3 molecules of NADPH

Identify the set of correct statements: A. The flowers of Vallisneria are colourful and produce nectar. B. The flowers of waterlily are not pollinated by water. C. In most of water-pollinated species, the pollen grains are protected from wetting. D. Pollen grains of some hydrophytes are long and ribbon like. E. In some hydrophytes, the pollen grains are carried passively inside water. Choose the correct answer from the options given below: (1) B, C, D and E only (2) C, D and E only (3) A, B, C and D only (4) A, C, D and E only

Epiphytes that are growing on a mango branch is an example of which of the following? (1) Commensalism (2) Mutualism (3) Predation (4) Amensalism

Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield? (1) Abscisic acid (2) Auxin (3) Gibberellin (4) Cytokinin

These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and fragmentation E. Migration. Choose the correct option: (1) A, B and D only (2) A, C and D only (3) A, B, C and D only (4) A, B and E only

Given below are two statements: Statement I : In C₃ plants, some O₂ binds to RuBisCO, hence CO₂ fixation is decreased. Statement II : In C₄ plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. In the light of the above statements, choose the correct answer from the options given below: (1) Statement I is false but Statement II is true (2) Both Statement I and Statement II are true (3) Both Statement I and Statement II are false (4) Statement I is true but Statement II is false

Given below are the stages in the life cycle of pteridophytes. Arrange the following stages in the correct sequence. A. Prothallus stage B. Meiosis in spore mother cells C. Fertilisation D. Formation of archegonia and antheridia in gametophyte. E. Transfer of antherozoids to the archegonia in presence of water. Choose the correct answer from the options given below: (1) B, A, D, E, C (2) B, A, E, C, D (3) D, E, C, A, B (4) E, D, C, B, A

Which are correct: A. Computed tomography and magnetic resonance imaging detect cancers of internal organs. B. Chemotherapeutics drugs are used to kill non-cancerous cells. C. α-interferon activate the cancer patients' immune system and helps in destroying the tumour. D. Chemotherapeutic drugs are biological response modifiers. E. In the case of leukaemia blood cell counts are decreased. Choose the correct answer from the options given below: (1) B and D only (2) D and E only (3) C and D only (4) A and C only

Which one of the following enzymes contains 'Haem' as the prosthetic group? (1) RuBisCo (2) Carbonic anhydrase (3) Succinate dehydrogenase (4) Catalase

Streptokinase produced by bacterium Streptococcus is used for (1) Curd production (2) Ethanol production (3) Liver disease treatment (4) Removing clots from blood vessels

Match List - I with List - II. List - I: A. Centromere B. Cilium C. Cristae D. Cell membrane. List - II: I. Mitochondrion II. Cell division III. Cell movement IV. Phospholipid Bilayer. Choose the correct answer from the options given below: (1) A-I, B-II, C-III, D-IV (2) A-II, B-I, C-IV, D-III (3) A-IV, B-II, C-III, D-I (4) A-II, B-III, C-I, D-IV

The complex II of mitochondrial electron transport chain is also known as (1) Cytochrome bc₁ (2) Succinate dehydrogenase (3) Cytochrome c oxidase (4) NADH dehydrogenase

From the statements given below choose the correct option: A. The eukaryotic ribosomes are 80S and prokaryotic ribosomes are 70S. B. Each ribosome has two sub-units. C. The two sub-units of 80S ribosome are 60S and 40S while that of 70S are 50S and 30S. D. The two sub-units of 80S ribosome are 60S and 20S and that of 70S are 50S and 20S. E. The two sub-units of 80S ribosome are 60S and 30S and that of 70S are 50S and 30S. (1) A, B, C are true (2) A, B, D are true (3) A, B, E are true (4) B, D, E are true

Given below are two statements: Statement I: The primary source of energy in an ecosystem is solar energy. Statement II: The rate of production of organic matter during photosynthesis in an ecosystem is called net primary productivity (NPP). In the light of the above statements, choose the most appropriate answer from the options given below: (1) Both statement I and statement II are correct (2) Both statement I and statement II are incorrect (3) Statement I is correct but statement II is incorrect (4) Statement I is incorrect but statement II is correct

Given below are two statements: Assertion (A): Both wind and water pollinated flowers are not very colourful and do not produce nectar. Reason (R): The flowers produce enormous amount of pollen grains in wind and water pollinated flowers. In the light of the above statements, choose the correct answer from the options given below: (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true but R is NOT the correct explanation of A (3) A is true but R is false (4) A is false but R is true

Match List I with List II: List-I: A. Alfred Hershey and Martha Chase B. Euchromatin C. Frederick Griffith D. Heterochromatin. List-II: I. Streptococcus pneumoniae II. Densely packed and dark-stained III. Loosely packed and light-stained IV. DNA as genetic material confirmation. Choose the correct answer from the options given below: (1) A-II, B-IV, C-I, D-III (2) A-IV, B-II, C-I, D-III (3) A-IV, B-III, C-I, D-II (4) A-III, B-II, C-IV, D-I

Polymerase chain reaction (PCR) amplifies DNA following the equation. (1) N² (2) 2ⁿ (3) 2n+1 (4) 2N²

Which of following organisms cannot fix nitrogen? A. Azotobacter B. Oscillatoria C. Anabaena D. Volvox E. Nostoc. Choose the correct answer from the options given below: (1) A only (2) D only (3) B only (4) E only

Which of the following is an example of actinomorphic flower? (1) Sesbania (2) Datura (3) Cassia (4) Pisum

Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of: (1) 10 bp (2) 8 bp (3) 6 bp (4) 4 bp

Read the following statements and choose the set of correct statements: In the members of Phaeophyceae. A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin. D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer from the options given below: (1) A, B, C and E only (2) A, B, C and D only (3) B, C, D and E only (4) A, C, D and E only

The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis? (1) Diakinesis (2) Zygotene (3) Pachytene (4) Diplotene

Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae. (1) Epiphyllous and Dithecous anthers (2) Diadelphous and Dithecous anthers (3) Polyadelphous and epipetalous stamens (4) Monoadelphous and Monothecous anthers

Identify the correct statements : A. Detrivores perform fragmentation. B. The humus is further degraded by some microbes during mineralization. C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. D. The detritus food chain begins with living organisms. E. Earthworms break down detritus into smaller particles by a process called catabolism. Choose the correct answer from the options given below : (1) D, E, A only (2) A, B, C only (3) B, C, D only (4) C, D, E only

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : ATP is used at two steps in glycolysis. Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. In the light of the above statements, choose the correct answer from the options given below : (1) A is false but R is true. (2) Both A and R are true and R is the correct explanation of A. (3) Both A and R are true but R is NOT the correct explanation of A. (4) A is true but R is false.

Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R : Assertion A : Late wood has fewer xylary elements with narrow vessels. Reason R : Cambium is less active in winters. In the light of the above statements, choose the correct answer from the options given below : (1) A is false but R is true. (2) Both A and R are true and R is the correct explanation of A. (3) Both A and R are true but R is NOT the correct explanation of A. (4) A is true but R is false.

Expressed Sequence Tags (ESTs) refers to (1) Certain important expressed genes. (2) All genes that are expressed as RNA. (3) All genes that are expressed as proteins. (4) All genes whether expressed or unexpressed.

Production of Cucumber has increased manifold in recent years. Application of which of the following phytohormones has resulted in this increased yield as the hormone is known to produce female flowers in the plants : (1) Cytokinin (2) ABA (3) Gibberellin (4) Ethylene

What are the potential drawbacks in adoption of the IVF method? A. High fatality risk to mother B. Expensive instruments and reagents C. Husband/wife necessary for being donors D. Less adoption of orphans E. Not available in India F. Possibility that the early embryo does not survive. Choose the correct answer from the options given below: (1) B, D, F only (2) A, C, D, F only (3) A, B, C, D only (4) A, B, C, E, F only

What is the name of the blood vessel that carries deoxygenated blood from the body to the heart in a frog? (1) Aorta (2) Pulmonary artery (3) Pulmonary vein (4) Vena cava

Which one of the following statements refers to Reductionist Biology? (1) Physico-chemical approach to study and understand living organisms. (2) Physiological approach to study and understand living organisms. (3) Chemical approach to study and understand living organisms. (4) Behavioural approach to study and understand living organisms.

Match List - I with List - II. List - I: A. Emphysema B. Angina Pectoris C. Glomerulonephritis D. Tetany. List - II: I. Rapid spasms in muscle due to low Ca^++ in body fluid II. Damaged alveolar walls and decreased respiratory surface III. Acute chest pain when not enough oxygen is reaching to heart muscle IV. Inflammation of glomeruli of kidney. Choose the correct answer from the options given below: (1) A-III, B-I, C-IV, D-II (2) A-III, B-I, C-II, D-IV (3) A-II, B-IV, C-III, D-I (4) A-II, B-III, C-IV, D-I

Which of the following statement is correct about location of the male frog copulatory pad? (1) First and Second digit of fore limb (2) First digit of hind limb (3) Second digit of fore limb (4) First digit of the fore limb

While trying to find out the characteristic of a newly found animal, a researcher did the histology of adult animal and observed a cavity with presence of mesodermal tissue towards the body wall but no mesodermal tissue was observed towards the alimentary canal. What could be the possible coelome of that animal? (1) Acoelomate (2) Pseudocoelomate (3) Schizocoelomate (4) Spongocoelomate

Match List - I with List - II. List - I: A. Head B. Middle piece C. Acrosome D. Tail. List - II: I. Enzymes II. Sperm motility III. Energy IV. Genetic material. Choose the correct answer from the options given below: (1) A-IV, B-III, C-I, D-II (2) A-IV, B-III, C-II, D-I (3) A-III, B-IV, C-II, D-I (4) A-III, B-II, C-I, D-IV

Cardiac activities of the heart are regulated by: A. Nodal tissue B. A special neural centre in the medulla oblongata C. Adrenal medullary hormones D. Adrenal cortical hormones. Choose the correct answer from the options given below: (1) A, B and C Only (2) A, B, C and D (3) A, C and D Only (4) A, B and D Only

Which of the following genetically engineered organisms was used by Eli Lilly to prepare human insulin? (1) Bacterium (2) Yeast (3) Virus (4) Phage

Name the class of enzyme that usually catalyze the following reaction: S-G + S^# → S + S^#-G Where, G → a group other than hydrogen, S → a substrate, S^# → another substrate. (1) Hydrolase (2) Lyase (3) Transferase (4) Ligase

Find the statement that is NOT correct with regard to the structure of monocot stem. (1) Hypodermis is parenchymatous. (2) Vascular bundles are scattered. (3) Vascular bundles are conjoint and closed. (4) Phloem parenchyma is absent.

Find the correct statements: A. In human pregnancy, the major organ systems are formed at the end of 12 weeks. B. In human pregnancy the major organ systems are formed at the end of 8 weeks. C. In human pregnancy heart is formed after one month of gestation. D. In human pregnancy, limbs and digits develop by the end of second month. E. In human pregnancy the appearance of hair is usually observed in the fifth month. Choose the correct answer from the options given below: (1) A and E Only (2) B and C Only (3) B, C, D and E Only (4) A, C, D and E Only

Which of the following diagrams is correct with regard to the proximal (P) and distal (D) tubule of the Nephron. (Four labelled diagrams showing ionic exchange at P and D tubules are given.) (1) (2) (3) (4)

What is the pattern of inheritance for polygenic trait? (1) Mendelian inheritance pattern (2) Non-mendelian inheritance pattern (3) Autosomal dominant pattern (4) X-linked recessive inheritance pattern

Each of the following characteristics represent a Kingdom proposed by Whittaker. Arrange the following in increasing order of complexity of body organization. A. Multicellular heterotrophs with cell wall made of chitin. B. Heterotrophs with tissue/organ/organ system level of body organization. C. Prokaryotes with cell wall made of polysaccharides and amino acids. D. Eukaryotic autotrophs with tissue/organ level of body organization. E. Eukaryotes with cellular body organization. Choose the correct answer from the options given below: (1) A, C, E, B, D (2) C, E, A, D, B (3) A, C, E, D, B (4) C, E, A, B, D

Who is known as the father of Ecology in India? (1) S. R. Kashyap (2) Ramdeo Misra (3) Ram Udar (4) Birbal Sahni

Match List - I with List - II. List I: A. Heart B. Kidney C. Gastro-intestinal tract D. Adrenal Cortex List II: I. Erythropoietin II. Aldosterone III. Atrial natriuretic factor IV. Secretin Choose the correct answer from the options given below : (1) A-II, B-I, C-III, D-IV (2) A-IV, B-III, C-II, D-I (3) A-I, B-III, C-IV, D-II (4) A-III, B-I, C-IV, D-II

Sweet potato and potato represent a certain type of evolution. Select the correct combination of terms to explain the evolution. (1) Analogy, convergent (2) Homology, divergent (3) Homology, convergent (4) Analogy, divergent

Match List I with List II : List I A. Common cold B. Haemozoin C. Widal test D. Allergy List II I. Plasmodium II. Typhoid III. Rhinoviruses IV. Dust mites Choose the correct answer from the options given below : (1) A-IV, B-II, C-III, D-I (2) A-II, B-IV, C-III, D-I (3) A-I, B-III, C-II, D-IV (4) A-III, B-I, C-II, D-IV

Consider the following : A. The reductive division for the human female gametogenesis starts earlier than that of the male gametogenesis. B. The gap between the first meiotic division and the second meiotic division is much shorter for males compared to females. C. The first polar body is associated with the formation of the primary oocyte. D. Luteinizing Hormone (LH) surge leads to disintegration of the endometrium and onset of menstrual bleeding. Choose the correct answer from the options given below : (1) A and B are true (2) A and C are true (3) B and D are true (4) B and C are true

Which of the following is not a natural/traditional contraceptive method? (1) Vaults (2) Coitus interruptus (3) Periodic abstinence (4) Lactational amenorrhoea

Given below are two statements: Statement I: Ligaments are dense irregular tissue. Statement II: Cartilage is dense regular tissue. In the light of the above statements, choose the correct answer from the options given below: (1) Statement I is false but Statement II is true. (2) Both Statement I and Statement II are true. (3) Both Statement I and Statement II are false. (4) Statement I is true but Statement II is false.

After maturation, in primary lymphoid organs, the lymphocytes migrate for interaction with antigens to secondary lymphoid organ(s) / tissue(s) like : A. thymus B. bone marrow C. spleen D. lymph nodes E. Peyer's patches Choose the correct answer from the options given below : (1) B, C, D only (2) A, B, C only (3) E, A, B only (4) C, D, E only

The first menstruation is called : (1) Menopause (2) Menarche (3) Diapause (4) Ovulation

Match List I with List II : List I A. Pons B. Hypothalamus C. Medulla D. Cerebellum List II I. Provides additional space for Neurons, regulates posture and balance II. Controls respiration and gastric secretions III. Connects different regions of the brain IV. Neuro secretory cells Choose the correct answer from the options given below : (1) A-II, B-I, C-III, D-IV (2) A-II, B-III, C-I, D-IV (3) A-III, B-IV, C-II, D-I (4) A-I, B-III, C-II, D-IV

Given below are two statements : one is labelled as Assertion (A) and the other is labelled as Reason (R). Assertion (A) : All vertebrates are chordates but all chordates are not vertebrate. Reason (R) : The members of subphylum Vertebrata possess notochord during the embryonic period, the notochord is replaced by a cartilaginous or bony vertebral column in adults. In the light of the above statements, choose the correct answer from the options given below : (1) Both A and R are true and R is the correct explanation of A (2) Both A and R are true but R is not the correct explanation of A (3) A is true but R is false (4) A is false but R is true

Which of the following microbes is NOT involved in the preparation of household products? A. Aspergillus niger B. Lactobacillus C. Trichoderma polysporum D. Saccharomyces cerevisiae E. Propionibacterium sharmanii Choose the correct answer from the options given below : (1) A and B only (2) A and C only (3) C and D only (4) C and E only

With the help of given pedigree, find out the probability for the birth of a child having no disease and being a carrier (has the disease mutation in one allele of the gene) in F3 generation. (Pedigree shown across F0-F3 with symbols: Unaffected male, Affected male, Carrier female, Unaffected female, Affected female.) (1) 1/4 (2) 1/2 (3) 1/8 (4) Zero

Match List I with List II : List I A. Fibrous joints B. Cartilaginous joints C. Hinge joints D. Ball and socket joints List II I. Adjacent vertebrae, limited movement II. Humerus and Pectoral girdle, rotational movement III. Skull, don't allow any movement IV. Knee, help in locomotion Choose the correct answer from the options given below : (1) A-III, B-I, C-IV, D-II (2) A-IV, B-II, C-III, D-I (3) A-I, B-III, C-II, D-IV (4) A-III, B-III, C-I, D-IV

Match List I with List II : List I A. Expiratory capacity B. Functional residual capacity C. Vital capacity D. Inspiratory capacity List II I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume II. Tidal volume + Expiratory reserve volume III. Tidal volume + Inspiratory reserve volume IV. Expiratory reserve volume + Residual volume Choose the correct answer from the options given below : (1) A-I, B-III, C-II, D-IV (2) A-II, B-IV, C-III, D-III (3) A-III, B-II, C-IV, D-I (4) A-II, B-I, C-IV, D-III

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5' (1) 5'ATGTACCGTTTATAGGTAAGT3' (2) 5'AUGUACCGUUUAUAGGUAAGU3' (3) 5'AUGUAAAGUUUAUAGGUAAGU3' (4) 5'AUGUACCGUUUAUAGGGAAGU3'

The following are the statements about non-chordates : A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous system is dorsal. D. Heart is dorsal if present. E. Post anal tail is absent. Choose the most appropriate answer from the options given below : (1) B, C & D only (2) A & C only (3) A, B & D only (4) B, D & E only

Match List I with List II : List I A. P wave B. QRS complex C. T wave D. T-P gap List II I. Heart muscles are electrically silent II. Depolarisation of ventricles III. Depolarisation of atria IV. Repolarisation of ventricles Choose the correct answer from the options given below : (1) A-IV, B-II, C-I, D-III (2) A-I, B-III, C-II, D-IV (3) A-III, B-II, C-IV, D-I (4) A-II, B-III, C-I, D-IV

Choose the correct statement given below regarding juxta medullary nephron. (1) Juxta medullary nephrons outnumber the cortical nephrons. (2) Juxta medullary nephrons are located in the columns of Bertini. (3) Renal corpuscle of juxta medullary nephron lies in the outer portion of the renal medulla. (4) Loop of Henle of juxta medullary nephron runs deep into medulla.

Match List I with List II : List I A. Non-medicated IUD B. Copper releasing IUD C. Hormone releasing IUD D. Implants List II I. Multiload 375 II. Progestogens III. Lippes loop IV. LNG-20 Choose the correct answer from the options given below : (1) A-III, B-I, C-IV, D-II (2) A-II, B-I, C-III, D-IV (3) A-I, B-III, C-IV, D-II (4) A-IV, B-I, C-II, D-III

Which of the following is not a cloning vector? (1) Probe (2) BAC (3) YAC (4) pBR322

Match List I with List II. List I A. Mast cells B. Inner surface of bronchiole C. Blood D. Tubular parts of nephron List II I. Ciliated epithelium II. Areolar connective tissue III. Cuboidal epithelium IV. specialised connective tissue Choose the correct answer from the options given below: (1) A-III, B-IV, C-II, D-I (2) A-I, B-II, C-IV, D-III (3) A-II, B-III, C-I, D-IV (4) A-II, B-I, C-IV, D-III

Given below are two statements : Statement I : The DNA fragments extracted from gel electrophoresis can be used in construction of recombinant DNA. Statement II : Smaller size DNA fragments are observed near anode while larger fragments are found near the wells in an agarose gel. In the light of the above statements, choose the most appropriate answer from the options given below : (1) Both statement I and statement II are correct (2) Both statement I and statement II are incorrect (3) Statement I is correct but statement II is incorrect (4) Statement I is incorrect but statement II is correct

Match List I with List II. List I: A. Adenosine B. Adenylic acid C. Adenine D. Alanine List II: I. Nitrogen base II. Nucleotide III. Nucleoside IV. Amino acid Choose the option with all correct matches. (1) A-III, B-IV, C-I, D-II (2) A-III, B-II, C-I, D-I (3) A-III, B-II, C-I, D-IV (4) A-II, B-III, C-I, D-IV

Match List I with List II : List I: A. Scutellum B. Non-albuminous seed C. Epiblast D. Perisperm List II: I. Persistent nucellus II. Cotyledon of Monocot seed III. Groundnut IV. Rudimentary cotyledon Choose the option with all correct matches. (1) A-II, B-III, C-IV, D-I (2) A-IV, B-III, C-II, D-I (3) A-IV, B-III, C-I, D-II (4) A-II, B-IV, C-III, D-I

Silencing of specific mRNA is possible via RNAi because of - (1) Complementary dsRNA (2) Inhibitory ssRNA (3) Complementary tRNA (4) Non-complementary ssRNA

Genes R and Y follow independent assortment. If RRYY produce round yellow seeds and rryy produce wrinkled green seeds, what will be the phenotypic ratio of the F2 generation? (1) Phenotypic ratio - 1 : 2 : 1 (2) Phenotypic ratio - 3 : 1 (3) Phenotypic ratio - 9 : 3 : 3 : 1 (4) Phenotypic ratio - 9 : 7

Histones are enriched with - (1) Lysine & Arginine (2) Leucine & Lysine (3) Phenylalanine & Leucine (4) Phenylalanine & Arginine

The protein portion of an enzyme is called : (1) Cofactor (2) Coenzyme (3) Apoenzyme (4) Prosthetic group

Which of the following is the unit of productivity of an Ecosystem? (1) gm^-2 (2) KCal m² (3) KCal m^-3 (4) (KCal m^-2)yr^-1

How many meiotic and mitotic divisions need to occur for the development of a mature female gametophyte from the megaspore mother cell in an angiosperm plant? (1) 2 Meiosis and 3 Mitosis (2) 1 Meiosis and 2 Mitosis (3) 1 Meiosis and 3 Mitosis (4) No Meiosis and 2 Mitosis

Which of the following is an example of a zygomorphic flower? (1) Petunia (2) Datura (3) Pea (4) Chilli

Given below are two statements : Statement I : Fig fruit is a non-vegetarian fruit as it has enclosed fig wasps in it. Statement II : Fig wasp and fig tree exhibit mutual relationship as fig wasp completes its life cycle in fig fruit and fig fruit gets pollinated by fig wasp. In the light of the above statements, choose the most appropriate answer from the options given below : (1) Both statement I and statement II are correct (2) Both statement I and statement II are incorrect (3) Statement I is correct but statement II is incorrect (4) Statement I is incorrect but statement II is correct

What is the main function of the spindle fibers during mitosis? (1) To separate the chromosomes (2) To synthesize new DNA (3) To repair damaged DNA (4) To regulate cell growth

Which one of the following is the characteristic feature of gymnosperms? (1) Seeds are enclosed in fruits. (2) Seeds are naked. (3) Seeds are absent. (4) Gymnosperms have flowers for reproduction.

Consider the following statements regarding function of adrenal medullary hormones : A. It causes pupilary constriction B. It is a hyperglycemic hormone C. It causes piloerection D. It increases strength of heart contraction Choose the correct answer from the options given below : (1) C and D Only (2) B, C and D Only (3) A, C and D Only (4) D Only

Match List I with List II. List I: A. Pteridophyte B. Bryophyte C. Angiosperm D. Gymnosperm List II: I. Salvia II. Ginkgo III. Polytrichum IV. Salvinia Choose the option with all correct matches. (1) A-III, B-IV, C-II, D-I (2) A-IV, B-III, C-I, D-II (3) A-III, B-IV, C-I, D-II (4) A-IV, B-III, C-II, D-I

Match List I with List II : List I: A. The Evil Quartet B. Ex situ conservation C. Lantana camara D. Dodo List II: I. Cryopreservation II. Alien species invasion III. Causes of biodiversity losses IV. Extinction Choose the option with all correct matches. (1) A-III, B-I, C-I, D-IV (2) A-III, B-I, C-II, D-IV (3) A-III, B-IV, C-II, D-I (4) A-III, B-II, C-IV, D-I

Given below are two statements : Statement I : In ecosystem, there is unidirectional flow of energy of sun from producers to consumers. Statement II : Ecosystems are exempted from 2nd law of thermodynamics. In the light of the above statements, choose the most appropriate answer from the options given below : (1) Both statement I and statement II are correct (2) Both statement I and statement II are incorrect (3) Statement I is correct but statement II is incorrect (4) Statement I is incorrect but statement II is correct

Which of the following statements about RuBisCO is true? (1) It is active only in the dark. (2) It has higher affinity for oxygen than carbon dioxide. (3) It is an enzyme involved in the photolysis of water. (4) It catalyzes the carboxylation of RuBP.

Read the following statements on plant growth and development. A. Parthenocarpy can be induced by auxins. B. Plant growth regulators can be involved in promotion as well as inhibition of growth. C. Dedifferentiation is a pre-requisite for re-differentiation. D. Abscisic acid is a plant growth promoter. E. Apical dominance promotes the growth of lateral buds. Choose the option with all correct statements. (1) A, B, C only (2) A, C, E only (3) A, D, E only (4) B, D, E only

Which one of the following equations represents the Verhulst-Pearl Logistic Growth of population? (1) dN/dt = r[(K-N)/K] (2) dN/dt = rN[(K-N)/K] (3) dN/dt = rN[(N-K)/N] (4) dN/dt = N[(r-K)/K]

Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below : (1) E-A-D-B-C (2) E-C-A-D-B (3) A-E-C-B-D (4) B-D-E-C-A

Match List I with List II : List I A. α-1 antitrypsin B. Cry IAb C. Cry IAc D. Enzyme replacement therapy List II I. Cotton bollworm II. ADA deficiency III. Emphysema IV. Corn borer Choose the correct answer from the options given below : (1) A-II, B-IV, C-I, D-III (2) A-II, B-I, C-IV, D-III (3) A-I, B-II, C-III, D-IV (4) A-III, B-IV, C-I, D-II

Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below : (1) E-C-A-D-B (2) C-E-D-A-B (3) E-B-D-A-C (4) B-E-A-C–D

Match List I with List II : List I A. Axoneme B. Cartwheel pattern C. Crista D. Satellite List II I. Centriole II. Cilia and flagella III. Chromosome IV. Mitochondria Choose the correct answer from the options given below : (1) A-II, B-I, C-IV, D-III (2) A-IV, B-III, C-II, D-I (3) A-III, B-II, C-I, D-IV (4) A-II, B-IV, C-I, D-III